danithstephan danithstephan

13-02-2016
Biology

contestada

The primary muscle of the lower leg is
a. gastrocnemius
b. hamstring
c. hip flexor
d. soleurs

Respuesta :

RASEA23 RASEA23

13-02-2016

A. gastrocnemius
I hope this helps.

Answer Link

Otras preguntas

Monte Services, Inc. is trying to establish the standard labor cost of a typical brake repair. The following data have been collected from time and motion studi

Give a reason why no moulding occurs during the adult stages of insects

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

A healthcare provider tested patients experiencing gluten intolerance to determine if they had celiac disease. The relative frequency table summarizes the data.

explain the differnece between a training data set and a variation data set. why are these data sets used routinely with data mining techniqeis in the xl miner

how many ways are there for eight blue-shirt and five red-shirt to stand in a line so that no two red-shirts stand next to each other?

Start -> A -> B -> C -> D -> E -> Finish. You have the following process information: Process A requires 10 minutes per widget. Process B does

A Byte of Accounting, Inc. Income Statement For Year Ending December 31, 2020 Revenues Sales Revenue $ 450,626.00 $ Cost of Goods Sold 225,212.00 $ Gross Profit

which best describes the innate ability to mentally group similar events, people, and things together?a. prototype.b. concept.c. algorithm.d. heuristic.

n 1986, a nuclear power accident in chernobyl, ukraine led to high radiation levels for kilometers surrounding the plant. the high levels of radiation caused el