20ygalvan 20ygalvan

12-12-2017
Mathematics

contestada

A(n) ________ is both equilateral and equiangular?

Respuesta :

AlexxOverstreet AlexxOverstreet

12-12-2017

i believe it was a rectangle I'm not sure test it out.

Answer Link

supportedbypitbulls supportedbypitbulls

12-12-2017

Regular polygons are both equilateral and equiangular.
Hope it helps!

Answer Link

Otras preguntas

It’s timed please help 3.2b-4.7b=3b-3.3 What dose b equal

A factory adds three red drops and two blue drops of coloring to white paint to make each pint of purple paint. The factory will make 50 gallons of this purple

Explain how you would graph the line containing a slope of -1/5 that goes through the point (1, -4).

Question: How can the reader infer that the man was at the White's house to deliver bad news? Answer: We can infer that the man's reasoning for being at the hou

Read the excerpt from "John Burns: The Unlikely Civil War Hero.” "I am going out to see what’s going on,” Burns said to his wife. Then he left the safety of his

if a snake species were introduced to an ecosystem where it had no natural predators, what long-term effect do you predict the snakes would have on the populati

Which quotation mark rule is true?A) Do not use quotation marks before and after indirect quotations.B) When a direct quotation is divided into two parts, the s

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

__________ is the most common type of stretching.

Quadratic Functions & Transformations 9-15 odd questions only