spreadlight10 spreadlight10

11-10-2017
Mathematics

contestada

I NEED MATH HELP, QUICK! PLEASE HELP ME!

Find f( -7) if f(x) = 3 - 2x.

Respuesta :

Аноним Аноним

11-10-2017

Plug in -7 for x in the equation...

f(x) = 3 - 2( - 7 )

f(x) = 3 + 14

f(x) = 17

Answer Link

Otras preguntas

Question 3 (10 points) How many 8' 2x4's and 12' 2x4's do you need to build a wall that is 12' long and 8' high The wall has a single bottom plate, double top p

Remember when the mother and father were talking as they sat in the cab of the truck and the mother stated her belief that the rich men come but their sons are

on their second date, corrine and marty talked in detail about their pasts, likes and dislikes, and common ideas for the future. their interactions are indicati

I need help with these bio

Which of the following statements is true about similar triangles? * A. The measurements of corresponding angles differ between the two triangles. B. Their corr

1. What is speculative risk? A. a formula that measures profit and loss. B. gain or increase in money and assets. C. loss of money or decrease in value. D. a ca

. the belief among adolescents that people are scrutinizing their appearance and behaviour is called imaginary audience. true false

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

the questions in this activity refer back to prelab 0, which would be a good place to look if you need any help. in test a, suppose you make 100 experimental me

a paper company needs to ship paper to a large printing business. the paper will be shipped in small boxes and large boxes. each small box of paper weighs 50 po