s689003 s689003

11-03-2021
Biology

contestada

What is the complementary strand of DNA to the one below?
AAACCGTATCCGCGGTATATCGCCGGAAT

Respuesta :

nsjwjwiaoaosksjja nsjwjwiaoaosksjja

11-03-2021

lick me , tease me , touch me , please me

AHAHA SORRY

Answer Link

05-04-2021

Answer:

TTTGGCATAGGCGCCATATAGCGGCCTTA

Answer Link

Otras preguntas

Events that happen at any time without warning and create considerable stress in a person's life are called:

Identify another name given to the Muslim invaders sorry but again help

There is a two-digit number whose units digit is six less than the tens digit. Four times the tens digit plus five times the units digit equal 51. Find the digi

Identify the essential element missing from the following topic sentence. Giving holiday gifts can be expensive! A. controlling idea B. limited topic C. conclu

how do you find the slope intercept form if you are given two triangles with one point over laped?

Which organ is the body's second largest organ and helps fight infections?

to cool foods quickly, place thema. in the refrigirator in deep containers.b. in refrigirator in large pots with tight fitting lids.c. in refrigirator after coo

A number cube is rolled and a random chip is pulled from a bag of 6 different color chips. The number cube is labeled 1 to 6. There is one blue chip in the bag.

If the central angle is 60 degrees, what is its arc measure?

Can someone help me check these answers ?