rotcbryan49 rotcbryan49

13-01-2021
Advanced Placement (AP)

contestada

Symptoms of headache nausea dizziness coupled with clamyvalin are signs of. Heat cramps. Heat exhaustion. Heat failure. Heat stroke

Respuesta :

jenniep2114 jenniep2114

13-01-2021

Answer:

I think it's heat exhaustion

Explanation:

Answer Link

Otras preguntas

Which U.S. GAAP principle or rule would apply if the net realizable value of a company's inventory is below its original cost? A. Historical cost principle B.

You learned about the general concept of parallax in Chapter 2, and the video offers a review of the basic ideas. To check your understanding of the concept, wh

Which statement describes the process the zygote undergoes immediately after fertilization?

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

Mandy cries when her parents ask her to do a chore and she does not have to do the chore. As a result, she is more likely to cry when her parents ask her to do

A researcher found a beautiful plant while traveling in Alaska and collected its seeds. When she came back to Florida, she soaked some seeds in pure water and s

Need an answer to this (all help appreciated)

Southern Lights Co. reported the following:Profit margin = 8.4 % Capital intensity ratio =0.45Debt-equity ratio = 0.60Net income = $95,000Dividends = $ 40,000Ba

please help thanks:)))))))))))))

Suppose 150 customers of a restaurant are chosen for a sample, but only 30 respond. What is this an example of? A. Selection bias B. Nonselection bias C. Nonr