sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

propose five ways in which the government can ensure that Road accident fund benefits are given to deserving beneficiaries

Which portion of the heart, when weakened by a heart attack, is responsible for causing fluid to back up into and engorge the lung tissue?

A recipe for 10 servings of raspberry sorbet calls for 2 cups of water, 1/1.2 cups of granulated sugar, and 4 cups of frozen raspberries, thawed. How many gallo

What is 40 percent of 50

Since most american media are privately owned:

Which statement best describes the popularity of Uncle Tom’s Cabin? Uncle Tom’s Cabin was most popular in the North. Uncle Tom’s Cabin was most popular in the S

When decision makers carefully and conscientiously execute all six stages of decision making, the decision makers are said to have exercised?

Which of the following are good ideas to use when gathering your resources? Check all that apply A. List potential formulas. B. Draw a diagram. C.

What can one expect to experience with exercise intensity?

compound verb: the rabbit sniffed the air and ran to safety.A) Rabbit, sniffed B) safety C) sniffed, ran D) the air