alexismcgreen alexismcgreen

13-02-2020
Physics

contestada

Can someone please help me with this question and I will give you brainlest
Also please make sure this is correct

Can someone please help me with this question and I will give you brainlest Also please make sure this is correct class=

Respuesta :

comeherequeer comeherequeer

13-02-2020

Answer:

PEENNISS

Explanation:

Answer Link

13-02-2020

Answer: 50%
Hope this helped

Answer Link

Otras preguntas

Describe two (2) impacts that trade had on Phoenicians and the World?

The meaning of The necklace

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

"Just one hour, una hora, is all I'm asking of you, son." My grandfather is in a nursing home in Brooklyn, and my mother wants me to spend some time with him, s

Sophie deposited $12,000 in an account that earned simple interest annually. - She did not make additional deposits; she did not make withdrawals. -At the end o

please help !!!!!!!!!

When does McCandless go into the Alaskan wilderness? A. spring B. winter C. Christmas day D. the day of his birthday E. no one knows

The critical angle for water is 49°. If a ray of light strikes the upper surface of a pond at an angle of incidence of 45°, will it be totally internally reflec

Can someone pls helpppp ASAP this is due in 25 min :( For the right triangles below, find the values of the side lengths d and a. Round your answers to the near

1. Which one sounds better?- origin of a _____ OR diaries of a _____? (I feel like the second one is commonly used.)2. Which is a top notch synonym for the word